| 3/30/2024 | 85285920 | 30730352#&Monochrome motor operating time information display, size 44.2x27.43mm, P/N: 30730352. 100% new product | XXXXXXXXXX | 1 | PCE | 71.7008 | USA | NA |
| 3/30/2024 | 38229090 | .#&PT ammonium reagent set 0.02-2.50 mg/L; 1 set with 3 bots: 1 bottle of 500ml: 1310-73-2(10-20%), 7774-29-0(<10%), 7681-82- 5(3-7%),1bot 50ml:7553-56-2(<0.1%),7681-82-5(<0.1%),1bot 50ml Mineral Stabilizer(12.01.0354) | XXXXXXXXXX | 25 | SET | 3042.475 | USA | NA |
| 3/30/2024 | 38229090 | Standard substance of silica analyzer (powder form 100g/package), CAS code No: 6153-56-6-REAGENT SI OXALIC ACID DIHYDRATE. | XXXXXXXXXX | 1 | UNK | 205.377 | USA | NA |
| 3/29/2024 | 38229090 | Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA . | XXXXXXXXXX | 10 | UNK | 802.33 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, TGCACCGACCTCACTTCGAA -0.1 ml/vial, product name: Enrich 2, 100% new product | XXXXXXXXXX | 2 | UNA | 163.4184 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, AACTCAGCTAGTGCTCCACG -0.1 ml/vial, product name: cps6I-R, 100% new product | XXXXXXXXXX | 1 | UNA | 6.2229 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, GATGATTTATGGCACCCGAGTAAGC -0.1 ml/vial, product name: cps7H-F, 100% new product | XXXXXXXXXX | 1 | UNA | 7.7812 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, TAAATAATATGCCACTGTAGCGTCTC -0.1 ml/vial, product name: cps2J-1/2J-R, 100% new product | XXXXXXXXXX | 1 | UNA | 8.0949 | USA | NA |
| 3/29/2024 | 38229090 | Hexamethylenetetramine reagent, pack/100 pieces, 0.1g/piece, HEXAMETHYLENETETRAMINE PK/100, for testing water environment, used in laboratories, brand: Hach, 2603999-VN. 100% new (KL=0.02kg) | XXXXXXXXXX | 2 | UNK | 151.28 | USA | NA |
| 3/29/2024 | 38229090 | Standard (reagent) GC/MS Sensitivity Test Mix (N9331078) for gas chromatography/mass spectrometry, 100% new, for laboratory use, HSX: PerkinElmer (1UNK= 2 vials), 1 vial=3ml, CAS: 540-84-1,113-72-4,119-61-9,118-74-1 | XXXXXXXXXX | 2 | UNK | 676.944 | USA | NA |