Latest Vietnam Import Data of Primer paints under HS Code 38229090

Discover World Bank Trade Data by Country with Exim GTIS

Exim Global Trade Information System is a cost effective business tool that helps you find potential business opportunities in the international market. Get accurate analytics and forecasts on industry wise international imports and exports, product pricing, production quantity, importers exporters shipments, competitors and risk involved in the business. Our analysts and industry professionals give our customers a fuller, more integrated perspective of their environment by linking data across variables. That is The New Intelligence's advantage. We can now identify cause and effect, risk, and opportunity in new ways, allowing our clients to make more confident decisions based on market intelligence reports of world trade data by country.

Schedule Demo

Industries we cover

Education & Academics

To assist researchers, educators, and trainees in filtering value from the noise of an ever-expanding digital universe, we promote world-class academic and educational practice across civilian, commercial, and military worlds.

Defense & Aerospace

Our offerings for the whole aviation and military supply chain make use of cutting-edge technology to provide an unrivaled mix of data, expertise, technical knowledge, and analytics.

Automotive

Exim’s auto specialists in various global countries help suppliers, dealers, and automakers understand and act on national and international opportunities, risk, legislation, and the disruptive influence of technology and big in-depth researched data. From concept design through sales, marketing, and aftermarket, we provide unrivaled data-driven solutions and services across the entire value chain.

Chemical

In the face of market volatility, regulatory challenges, geopolitical risk, and altering end-user demand, we assist industry leaders in making confident decisions. Use data on economic and country risk, hydrocarbon and raw material trends, supply- and distribution-chain management, and environmental compliance to help you make better decisions.

Construction

For the ever-changing construction sector, building material suppliers, construction equipment firms, architects, and contractors may receive reliable and timely data, analysis, research, and insight into the present and future market circumstances and building requirements.

Natural Resources & Energy

Energy has you covered whether you need to find the safest drilling location, assess an oil asset, or evaluate a solar array investment. Our 600+ energy specialists and 800+ geoscientists and engineers use proprietary data and sophisticated analytics to provide insights into the full energy value chain, from underground oil, gas, and coal to renewables, local gas stations, and worldwide power grids.

Maritime & Commercial

Our expertise and insight, based on a more than 250-year history of information collection, assist you in navigating the complicated environment of the seaborne trade. For the marine, security, and energy-trading groups, resources include ownership data, live ship movements, risk profiles, and intelligence tools.

Services in the Financial Sector

Bankers, asset managers, corporate finance experts, and insurers all across the world must weigh economic instability, geopolitical turmoil, and interconnected industry dynamics when making investment and lending choices. With our award-winning economic predictions and analyses, Financial & Capital Markets aids you in strategic planning as well as managing your investment and loan portfolios.

HS Code

38229090(974)

Country

Port of Unloading

na(974)

DATE	HS CODE	PRODUCT DESCRIPTION	EXPORTER	QUANTITY	UNIT	TOTAL VALUE USD	ORIGIN COUNTRY	PORT OF UNLOADING
3/29/2024	38229090	Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA .	XXXXXXXXXX	10	UNK	802.33	USA	NA
3/29/2024	38229090	Reagents for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA -0.1 ml/vial, product name: Truseq Primer, 100% new product	XXXXXXXXXX	2	UNA	191.4002	USA	NA
3/27/2024	38229090	Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 3), 8.83 ml/vial, Code: E6444L, 100% new product	XXXXXXXXXX	1	UNA	1490.67	USA	NA
3/27/2024	38229090	Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2, 8.83 ml/vial, Code: E6442L, 100% new product	XXXXXXXXXX	1	UNA	1490.67	USA	NA
3/26/2024	38229090	Standard used to analyze sample quality Synthetic DNA Primer, cat no: EQ-PALT, used in laboratory biological research, 2 vials/1 box (1g/1 vial) manufacturer: UK Neqas, 100% new	XXXXXXXXXX	1	UNK	240.824	United Kingdom	NA
3/25/2024	38229090	Standard used to analyze sample quality Synthetic DNA Primer, cat no: EQ-PALT, used in laboratory biological research, 2 vials/1 box (1g/1 vial) manufacturer: UK Neqas, 100% new	XXXXXXXXXX	1	UNK	240.824	United Kingdom	NA
3/25/2024	38229090	Genome reagent (detects gene mutations on DNA sequences) used in experiments, 100% new, manufacturer: Cryos International: GIF-MOT20-IUI primer kit - 50 reactions/kit, code ITEM0017578	XXXXXXXXXX	1	SET	268.699	Denmark	NA
3/22/2024	38229090	IC-R, specification: 1um, PCR reaction primer in molecular biology laboratory, 100% new product	XXXXXXXXXX	1	UNA	37.29	Singapore	NA
3/22/2024	38229090	Pure standard for molecular biology testing: Random Hexamer Primer (SO142), 1 ml/1 vial, used in laboratories, Expiration date: December 31, 2025: Expiration date: Thermo	XXXXXXXXXX	1	UNA	50.9136	Lithuania	NA
3/22/2024	38229090	IC-F, specification: 1um, PCR reaction primer in molecular biology laboratory, 100% new product	XXXXXXXXXX	1	UNA	32.43	Singapore	NA

Search Global Export - Import Trade Data

Exim Trade Data provides 100% genuine and the latest Import data of Primer paints under HS code 38229090 Vietnam. We collect Import data of Primer paints under HS code 38229090 with product anddate.Import data of Primer paints under HS code 38229090 Vietnam helps to analyze Import price, companyname, port, importer and exporter, product description, quantity, market trends, and many other datapoints.International Trade data of a country helps the global exporters and importers to do analysis and marketresearch to find local suppliers and buyers in that country.

Accelerate your export-import trade by data-based decision & avoid risk.
Align your business model with global strategic planning & stay ahead.

Expand Your Business Network

Risk Free Market Entry Strategy

Authentic Export-Import trade data

Get Latest Vietnam Import Data of Primer paints under HS Code 38229090