| 3/30/2024 | 35069900 | 3M VHB Tape Universal Primer UV Glue, 1.2kg/bottle. New 100% | XXXXXXXXXX | 2 | UNK | 65.0142 | USA | NA |
| 3/30/2024 | 35061000 | 3M VHP TAPE universal Primer UV prepared glue ingredients include: Heptane, branched, cyclic and linear, Methyl acetate, capacity: 946 ml/box, net weight not more than 1kg/bottle, 100% new product | XXXXXXXXXX | 2 | UNA | 101.8286 | USA | NA |
| 3/29/2024 | 38229090 | Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA . | XXXXXXXXXX | 10 | UNK | 802.33 | USA | NA |
| 3/29/2024 | 38229090 | Reagents for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA -0.1 ml/vial, product name: Truseq Primer, 100% new product | XXXXXXXXXX | 2 | UNA | 191.4002 | USA | NA |
| 3/27/2024 | 38229090 | Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 3), 8.83 ml/vial, Code: E6444L, 100% new product | XXXXXXXXXX | 1 | UNA | 1490.67 | USA | NA |
| 3/27/2024 | 38229090 | Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2, 8.83 ml/vial, Code: E6442L, 100% new product | XXXXXXXXXX | 1 | UNA | 1490.67 | USA | NA |
| 3/26/2024 | 33049930 | Moisturizer-Ultra Light Hydrator 50g, helps restore moisture to the skin, can be used as a makeup primer. Box/ 1 tube. Batch:WN0356.HSD: 09/2026.SCB:108715/19/CBMP- QLD.NSX:Milbar Laboratories, Inc | XXXXXXXXXX | 1000 | UNK | 7320 | USA | NA |
| 3/26/2024 | 32089090 | B06JA#&B06JA primer solution (27kg/can)-Inorganic Zinc Primer includes:Zinc43-45%;Aluminium4-6%;Pentane4-dione0-2%;Ethylbenzene6-8%;Naphthalene<1%)(108,000g=4can =108kg)(m32 tk 105771509100/C11 -5/10/23) | XXXXXXXXXX | 108000 | GRM | 2635.2 | USA | NA |
| 3/26/2024 | 32149000 | Gap sealant and elastic adhesive for water park slides, used in construction, insoluble in water, not heat resistant, brand Sika Primer-215, packaging: 250ml/can, 6 cans/carton .New100% | XXXXXXXXXX | 18 | UNK | 2161.53 | USA | NA |
| 3/26/2024 | 32149000 | Gap sealant and elastic adhesive for water park slides, used in construction, insoluble in water, not heat resistant, brand Sika Primer-215, packaging: 250ml/can, 6 cans/carton .New100% | XXXXXXXXXX | 28 | UNK | 3362.38 | USA | NA |