Get Latest Vietnam Primer paints Import Data from Usa

Discover World Bank Trade Data by Country with Exim GTIS

Exim Global Trade Information System is a cost effective business tool that helps you find potential business opportunities in the international market. Get accurate analytics and forecasts on industry wise international imports and exports, product pricing, production quantity, importers exporters shipments, competitors and risk involved in the business. Our analysts and industry professionals give our customers a fuller, more integrated perspective of their environment by linking data across variables. That is The New Intelligence's advantage. We can now identify cause and effect, risk, and opportunity in new ways, allowing our clients to make more confident decisions based on market intelligence reports of world trade data by country.

Schedule Demo

Industries we cover

Education & Academics

To assist researchers, educators, and trainees in filtering value from the noise of an ever-expanding digital universe, we promote world-class academic and educational practice across civilian, commercial, and military worlds.

Defense & Aerospace

Our offerings for the whole aviation and military supply chain make use of cutting-edge technology to provide an unrivaled mix of data, expertise, technical knowledge, and analytics.

Automotive

Exim’s auto specialists in various global countries help suppliers, dealers, and automakers understand and act on national and international opportunities, risk, legislation, and the disruptive influence of technology and big in-depth researched data. From concept design through sales, marketing, and aftermarket, we provide unrivaled data-driven solutions and services across the entire value chain.

Chemical

In the face of market volatility, regulatory challenges, geopolitical risk, and altering end-user demand, we assist industry leaders in making confident decisions. Use data on economic and country risk, hydrocarbon and raw material trends, supply- and distribution-chain management, and environmental compliance to help you make better decisions.

Construction

For the ever-changing construction sector, building material suppliers, construction equipment firms, architects, and contractors may receive reliable and timely data, analysis, research, and insight into the present and future market circumstances and building requirements.

Natural Resources & Energy

Energy has you covered whether you need to find the safest drilling location, assess an oil asset, or evaluate a solar array investment. Our 600+ energy specialists and 800+ geoscientists and engineers use proprietary data and sophisticated analytics to provide insights into the full energy value chain, from underground oil, gas, and coal to renewables, local gas stations, and worldwide power grids.

Maritime & Commercial

Our expertise and insight, based on a more than 250-year history of information collection, assist you in navigating the complicated environment of the seaborne trade. For the marine, security, and energy-trading groups, resources include ownership data, live ship movements, risk profiles, and intelligence tools.

Services in the Financial Sector

Bankers, asset managers, corporate finance experts, and insurers all across the world must weigh economic instability, geopolitical turmoil, and interconnected industry dynamics when making investment and lending choices. With our award-winning economic predictions and analyses, Financial & Capital Markets aids you in strategic planning as well as managing your investment and loan portfolios.

HS Code

Country

USA(1021)

Port of Unloading

DATE	HS CODE	PRODUCT DESCRIPTION	EXPORTER	QUANTITY	UNIT	TOTAL VALUE USD	ORIGIN COUNTRY	PORT OF UNLOADING
3/30/2024	35069900	3M VHB Tape Universal Primer UV Glue, 1.2kg/bottle. New 100%	XXXXXXXXXX	2	UNK	65.0142	USA	NA
3/30/2024	35061000	3M VHP TAPE universal Primer UV prepared glue ingredients include: Heptane, branched, cyclic and linear, Methyl acetate, capacity: 946 ml/box, net weight not more than 1kg/bottle, 100% new product	XXXXXXXXXX	2	UNA	101.8286	USA	NA
3/29/2024	38229090	Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA .	XXXXXXXXXX	10	UNK	802.33	USA	NA
3/29/2024	38229090	Reagents for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA -0.1 ml/vial, product name: Truseq Primer, 100% new product	XXXXXXXXXX	2	UNA	191.4002	USA	NA
3/27/2024	38229090	Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 3), 8.83 ml/vial, Code: E6444L, 100% new product	XXXXXXXXXX	1	UNA	1490.67	USA	NA
3/27/2024	38229090	Reagents for laboratory use, manufacturer: NEB, NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) Set 2, 8.83 ml/vial, Code: E6442L, 100% new product	XXXXXXXXXX	1	UNA	1490.67	USA	NA
3/26/2024	33049930	Moisturizer-Ultra Light Hydrator 50g, helps restore moisture to the skin, can be used as a makeup primer. Box/ 1 tube. Batch:WN0356.HSD: 09/2026.SCB:108715/19/CBMP- QLD.NSX:Milbar Laboratories, Inc	XXXXXXXXXX	1000	UNK	7320	USA	NA
3/26/2024	32089090	B06JA#&B06JA primer solution (27kg/can)-Inorganic Zinc Primer includes:Zinc43-45%;Aluminium4-6%;Pentane4-dione0-2%;Ethylbenzene6-8%;Naphthalene<1%)(108,000g=4can =108kg)(m32 tk 105771509100/C11 -5/10/23)	XXXXXXXXXX	108000	GRM	2635.2	USA	NA
3/26/2024	32149000	Gap sealant and elastic adhesive for water park slides, used in construction, insoluble in water, not heat resistant, brand Sika Primer-215, packaging: 250ml/can, 6 cans/carton .New100%	XXXXXXXXXX	18	UNK	2161.53	USA	NA
3/26/2024	32149000	Gap sealant and elastic adhesive for water park slides, used in construction, insoluble in water, not heat resistant, brand Sika Primer-215, packaging: 250ml/can, 6 cans/carton .New100%	XXXXXXXXXX	28	UNK	3362.38	USA	NA

Search Global Export - Import Trade Data

Exim Trade Data provides 100% genuine and the latest Primer paints Import Data of Vietnamfrom Usa. We collect Primer paints Import Data of Vietnam from Usa with product and date. Primer paints ImportData of Vietnam from Usa helps to analyze Import price, company name, port, importer and exporter,product description, quantity, market trends, and many other data points.International Trade data of a country helps the global exporters and importers to do analysis and marketresearch to find local suppliers and buyers in that country.

Accelerate your export-import trade by data-based decision & avoid risk.
Align your business model with global strategic planning & stay ahead.

Expand Your Business Network

Risk Free Market Entry Strategy

Authentic Export-Import trade data