| 3/29/2024 | 38229090 | Reagents for laboratory use, manufacturer: IDT, 100 nm PrimeTime, /5HEX/CT TTC CCG TAT TCT GTC CGT TGA AGC /3BHQ1 -0.1 ml/vial, product name: Probe-RulA-R, 100% new product | XXXXXXXXXX | 1 | UNA | 283.827 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 250 nm PrimeTime, Texas Red/ ATTCCGCTTACCTCTATCCAACTCT / BHQ2 -0.1 ml/vial, product name: My hyosynoviae Probe, 100% new product | XXXXXXXXXX | 2 | UNA | 926.56 | USA | NA |
| 3/29/2024 | 38229090 | Reagents for laboratory use, manufacturer: IDT, 100 nm PrimeTime, FAM / TGT GGT GAA TGG CAC TGA TTG ACA / BHQ1 -0.1 ml/vial, product name: PRRS-NA-Probe, 100% new product | XXXXXXXXXX | 1 | UNA | 230.502 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 100 nm PrimeTime, HEX / CGCGTAGAACTGTGACAACAACGCTGA / BHQ1 -0.1 ml/vial, product name: PRRS-CN-Probe, 100% new product | XXXXXXXXXX | 1 | UNA | 283.827 | USA | NA |
| 3/29/2024 | 38229090 | Reagents for laboratory use, manufacturer: IDT, 100 nm PrimeTime, FAM / CCT CTG CTT GCA ATC GAT CCA GAC / BHQ1 -0.1 ml/vial, product name: PRRS-EU-Probe, 100% new product | XXXXXXXXXX | 1 | UNA | 230.502 | USA | NA |
| 3/29/2024 | 38229090 | Reagents used in the experiment, 100% new, manufacturer: Nanjing Vazyme Biotech: Taq Pro Multiple Probe qPCR Mix 2500 reactions/kit, code:QN213-EN03 | XXXXXXXXXX | 3 | SET | 891 | China | NA |
| 3/29/2024 | 38229090 | Standard solution for DO measuring probe, 25ML/bottle, BOTTLE OF ELECTROLYTE OXYGEN PPM, 25 ML, for testing water environment, used in laboratories, 09181=A=3600-VN, brand: Hach. 100% new (KL=0.025kg) | XXXXXXXXXX | 1 | UNA | 79.23 | Germany | NA |
| 3/28/2024 | 38229090 | Reagent for qualitative testing of P53 gene abnormalities using FISH technique: CLL chromosome and gene anomaly probe detection kit, product code: FP-014-2, 10 tests/box, 100% new | XXXXXXXXXX | 2 | UNK | 439.13 | China | NA |
| 3/28/2024 | 38229090 | Reagent for qualitative testing of ETV6(TEL)/RUNX1(AML1) gene abnormalities using FISH technique: ETV6(TEL)-RUNX1(AML1) gene translocation probe reagent, product code: FP-029, 10 tests/box, new 100% | XXXXXXXXXX | 1 | UNK | 219.565 | China | NA |
| 3/28/2024 | 38229090 | Reagent for qualitative testing of 1q21/1p32 gene abnormalities using FISH technique: 1q21 and 1p32 Gene Anomaly Probe reagent, product code: FP-197, 10 tests/box, 100% new | XXXXXXXXXX | 1 | UNK | 219.565 | China | NA |