Latest Vietnam Import Data Under HS Code 38229090 to usa
Complete Detailed Competitor Analysis through our latest IMPORT Data of Vietnam.
Trade Data
| DATE | HS CODE | PRODUCT DESCRIPTION | IMPORTER | QUANTITY | UNIT | TOTAL VALUE USD | ORIGIN COUNTRY | PORT OF UNLOADING | Action |
|---|---|---|---|---|---|---|---|---|---|
| 2024-03-30 | 38229090 | Standard solution PH = 4, used to analyze chemical concentrations and ratios. Brand new 100%#&US | DAE MYUNG VIETNAM COMPANY LIMITED | 2 | UNA | 43.072 | USA | NA | |
| 2024-03-30 | 38229090 | Standard solution PH = 7, used to analyze chemical concentrations and ratios. Brand new 100%#&US | DAE MYUNG VIETNAM COMPANY LIMITED | 2 | UNA | 46.3226 | USA | NA | |
| 2024-03-30 | 38229090 | Standard to activate sodium Na+ concentration measuring device, 3 bottles/set: 1L/bottle of sodium, 250ml/bottle of ph7, 250ml/bottle of pH10; Cas code: 7732-18-5, 10028-24-7, 7778-77-0, 1310-73-2 - ACCESSORY STARTUP KIT 2300NA. | METTLERTOLEDO VIETNAM ONE MEMBER COMPANY LIMITED | 1 | SET | 204.379 | USA | NA | |
| 2024-03-30 | 38229090 | .#&PT ammonium reagent set 0.02-2.50 mg/L; 1 set with 3 bots: 1 bottle of 500ml: 1310-73-2(10-20%), 7774-29-0(<10%), 7681-82- 5(3-7%),1bot 50ml:7553-56-2(<0.1%),7681-82-5(<0.1%),1bot 50ml Mineral Stabilizer(12.01.0354) | JA SOLAR PV VIETNAM COMPANY LIMITED | 25 | SET | 3042.475 | USA | NA | |
| 2024-03-30 | 38229090 | Standard solution PH = 10, used to analyze chemical concentrations and ratios. Brand new 100%#&US | DAE MYUNG VIETNAM COMPANY LIMITED | 2 | UNA | 89.3946 | USA | NA | |
| 2024-03-30 | 38229090 | Standard substance of silica analyzer (powder form 100g/package), CAS code No: 6153-56-6-REAGENT SI OXALIC ACID DIHYDRATE. | METTLERTOLEDO VIETNAM ONE MEMBER COMPANY LIMITED | 1 | UNK | 205.377 | USA | NA | |
| 2024-03-29 | 38229090 | Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA . | ALPHA COACH SCIENCE AND TECHNOLOGY COMPANY LIMITED | 10 | UNK | 802.33 | USA | NA | |
| 2024-03-29 | 38229090 | Ion ReproSeq PGS running chemicals (A34899), box of 7 vials x 5ml, used for genetic analyzers, 100% new products, for laboratory use, Expiry date: February 28, 2026, HSX: Applied Biosystem/Life technologies | SISC Vietnam Equipment Joint Stock Company | 1 | UNK | 3410.34 | USA | NA | |
| 2024-03-29 | 38229090 | Reagents for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, CGC TGT CTC AGA GTG GGC TGA GC -0.1 ml/vial, product name: EAPV IB -R, 100% new product | BCE Vietnam Company Limited | 1 | UNA | 6.336 | USA | NA | |
| 2024-03-29 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, TGCACCGACCTCACTTCGAA -0.1 ml/vial, product name: Enrich 2, 100% new product | BCE Vietnam Company Limited | 2 | UNA | 163.4184 | USA | NA |
Search Global Export - Import Trade Data
Exim Trade Data provides 100% genuine and the latest IMPORT Data under HS Code 38229090 of vietnam to usa. We collect IMPORT Data under HS Code 38229090 of vietnam to usa with product and date. IMPORT Data helps to analyze IMPORT price, company name, port, Importer and exporter, product description, quantity, market trends, and many other data points. International Trade data of a country helps the global exporters and importers to do analysis and market research to find local suppliers and buyers in that country.
Vietnam Customs Shipment Data | Verified Trade Information
Vietnam Customs Shipment Data offers a detailed and dependable overview of the country’s international trade, sourced from official systems managed by the General Department of Vietnam Customs. Every shipment is recorded through structured customs procedures and backed by essential trade documents such as invoices, declarations, and shipping records, ensuring strong data authenticity. The dataset includes key fields like HS codes, product descriptions, importer and exporter names, shipment values, quantities, and port information. As one of the fastest-growing economies in Southeast Asia, Vietnam’s shipment data helps businesses track real trade movements and identify reliable market opportunities.
Verified Vietnam Import Data | Detailed Trade Insights
Vietnam import data provides a clear understanding of the country’s sourcing patterns by capturing actual shipment-level transactions. The country imports a wide range of goods, including machinery, electronic components, raw materials, fuels, and chemicals to support its manufacturing sector. By analyzing this data, businesses can identify key importers, evaluate supplier countries, and monitor pricing trends. It also helps companies understand supply chain dynamics and uncover new opportunities in Vietnam’s rapidly expanding import market.