| 3/30/2024 | 38229090 | Blood glucose test strips for use with On-Call Plus personal blood glucose meter (25 strips/box) (blister type) (G133-115) Lot: 1693766/92/96, HD: January 23, 2026 & 01, February 2, 2026, 100% new (1 kit = 1 box) | XXXXXXXXXX | 100000 | KIT | 151010 | China | NA |
| 3/30/2024 | 38229090 | Reagent LH-DE-100. New 100% | XXXXXXXXXX | 20 | UNK | 995.302 | South Korea | NA |
| 3/30/2024 | 38229090 | Experimental reagent that prevents the catalyst from protecting the sensor - prevents the sensor from exchanging electrons with the environment, 1 box of 6 bottles of 30ml/box, Cas code: 64-17-5; 7447-41-8; 78-93-3 -LICL 1M/ETOH ELECTROLYTE 6X30ML. | XXXXXXXXXX | 6 | UNK | 654.588 | Switzerland | NA |
| 3/30/2024 | 38229090 | .#&PT ammonium reagent set 0.02-2.50 mg/L; 1 set with 3 bots: 1 bottle of 500ml: 1310-73-2(10-20%), 7774-29-0(<10%), 7681-82- 5(3-7%),1bot 50ml:7553-56-2(<0.1%),7681-82-5(<0.1%),1bot 50ml Mineral Stabilizer(12.01.0354) | XXXXXXXXXX | 25 | SET | 3042.475 | USA | NA |
| 3/30/2024 | 38229090 | LH-N2N3 reagent, Ammonia nitrogen test. New 100% | XXXXXXXXXX | 20 | UNK | 1323.91 | South Korea | NA |
| 3/30/2024 | 38229090 | Experimental reagent to prevent catalyst protection - prevents the sensor from exchanging electrons with the environment, 1 box of 3 packs of 25ml/package, CAS-No.: 7732-18-5, 1310-58-3 - O2 ELECTROLYTE PACK 3X25ML. | XXXXXXXXXX | 2 | UNK | 134.0988 | Switzerland | NA |
| 3/30/2024 | 38229090 | Standard substance of silica analyzer (powder form 100g/package), CAS code No: 6153-56-6-REAGENT SI OXALIC ACID DIHYDRATE. | XXXXXXXXXX | 1 | UNK | 205.377 | USA | NA |
| 3/29/2024 | 38229090 | Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA . | XXXXXXXXXX | 10 | UNK | 802.33 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, TGCACCGACCTCACTTCGAA -0.1 ml/vial, product name: Enrich 2, 100% new product | XXXXXXXXXX | 2 | UNA | 163.4184 | USA | NA |
| 3/29/2024 | 38229090 | Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, AACTCAGCTAGTGCTCCACG -0.1 ml/vial, product name: cps6I-R, 100% new product | XXXXXXXXXX | 1 | UNA | 6.2229 | USA | NA |