Get Latest Vietnam Urine reagent strips Import Data from Usa

Get latest Customs Import data of Vietnam from Itlay for HS code . Discover valuable information such as Product Name, Price, Value, Unit, Quantity, Importer Port Name, and more shipment details based on invoices, shipping bill and other documents for better market research.


DATEHS CODEPRODUCT DESCRIPTIONEXPORTERQUANTITYUNITTOTAL VALUE USDORIGIN COUNTRYPORT OF UNLOADING
3/30/202438229090.#&PT ammonium reagent set 0.02-2.50 mg/L; 1 set with 3 bots: 1 bottle of 500ml: 1310-73-2(10-20%), 7774-29-0(<10%), 7681-82- 5(3-7%),1bot 50ml:7553-56-2(<0.1%),7681-82-5(<0.1%),1bot 50ml Mineral Stabilizer(12.01.0354)XXXXXXXXXX25SET3042.475USANA
3/30/202438229090Standard substance of silica analyzer (powder form 100g/package), CAS code No: 6153-56-6-REAGENT SI OXALIC ACID DIHYDRATE.XXXXXXXXXX1UNK205.377USANA
3/29/202438229090Standard reagent for checking BOD content (polyseed - BOD primer) used in analyzing BOD indicators in environmental laboratories, Part no: P110, 50 tablets/box, 100% new, origin: InterLab, USA .XXXXXXXXXX10UNK802.33USANA
3/29/202438229090Reagent for laboratory use, manufacturer: IDT, 250 nmole DNA Oligos, TGCACCGACCTCACTTCGAA -0.1 ml/vial, product name: Enrich 2, 100% new productXXXXXXXXXX2UNA163.4184USANA
3/29/202438229090Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, AACTCAGCTAGTGCTCCACG -0.1 ml/vial, product name: cps6I-R, 100% new productXXXXXXXXXX1UNA6.2229USANA
3/29/202438229090Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, GATGATTTATGGCACCCGAGTAAGC -0.1 ml/vial, product name: cps7H-F, 100% new productXXXXXXXXXX1UNA7.7812USANA
3/29/202438229090Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, TAAATAATATGCCACTGTAGCGTCTC -0.1 ml/vial, product name: cps2J-1/2J-R, 100% new productXXXXXXXXXX1UNA8.0949USANA
3/29/202438229090Hexamethylenetetramine reagent, pack/100 pieces, 0.1g/piece, HEXAMETHYLENETETRAMINE PK/100, for testing water environment, used in laboratories, brand: Hach, 2603999-VN. 100% new (KL=0.02kg)XXXXXXXXXX2UNK151.28USANA
3/29/202438229090Standard (reagent) GC/MS Sensitivity Test Mix (N9331078) for gas chromatography/mass spectrometry, 100% new, for laboratory use, HSX: PerkinElmer (1UNK= 2 vials), 1 vial=3ml, CAS: 540-84-1,113-72-4,119-61-9,118-74-1XXXXXXXXXX2UNK676.944USANA
3/29/202438229090Reagent for laboratory use, manufacturer: IDT, 100 nmole DNA Oligos, ATGGGCGTTGGCGGGAGTTT -0.1 ml/vial, product name: cps8H-F, 100% new productXXXXXXXXXX1UNA6.2229USANA

Search Global Export - Import Trade Data

Search Global Export - Import Trade Data

Exim Trade Data provides 100% genuine and the latest Urine reagent strips Import Data of Vietnamfrom Usa. We collect Urine reagent strips Import Data of Vietnam from Usa with product and date. Urine reagent strips ImportData of Vietnam from Usa helps to analyze Import price, company name, port, importer and exporter,product description, quantity, market trends, and many other data points.International Trade data of a country helps the global exporters and importers to do analysis and marketresearch to find local suppliers and buyers in that country.

  • Accelerate your export-import trade by data-based decision & avoid risk.
  • Align your business model with global strategic planning & stay ahead.
Market Research

Expand Your Business Network

Global market data

Risk Free Market Entry Strategy

Export-Import trade data

Authentic Export-Import trade data

Import-Export Trade data

Lightning and Reliable Export-Import Trade data